Self-propagating mRNAs, a novel gene therapy method and delivery vector
By Yancheng Li
Self-propagating mRNAs could be engineered to replicate itself and exit cells via microvesicles. They could be used in gene therapy to express target genes without disrupting the genomic DNA. These mRNAs have multiple open reading frames (ORFs). Some ORFs encode the non-structural proteins (nsp) of RNA replicase, which allows the mRNA strand to self-amplify. An ORF encodes for an RNA-binding protein like TetR. TetR is a tetracycline-responsive translational repressor that binds specific RNA motifs. TetR could be used to regulate the expression of nsp or of the target genes by the addition of doxycycline.
The 3’ UTR of the self-propagating mRNA contains a 25-nucleotide zipcode (ACCCTGCCGCCTGGACTCCGCCTGT). The zipcode contains a CTGCC core sequence and a miRNA-binding site for miR-1289. The zipcode mediates mRNA exit by microvesicles. Increasing the miR-1289 concentration in cells increases the enrichment of the target mRNA in microvesicles. There could be a sequence in the mRNA that is replicated by RNA replicase to produce miR-1289 transcripts. The miR-1289 and miRNA-binding site could be mutated, so that the miRNA would specifically bind to self-propagating mRNAs and not to endogenous mRNAs. Microvesicles could act as non-immunogenic and regeneratable delivery vectors that allow mRNA to propagate through physiological barriers.
·